Journal: Developmental cell

Article Title: De novo endocytic clathrin coats develop curvature at early stages of their formation.

doi: 10.1016/j.devcel.2021.10.019

Figure Lengend Snippet: Figure 2. TIRF-SIM imaging allows analysis of curvature generation by clathrin pits with high spatiotemporal resolution in cultured cells and in tissues of Drosophila embryos Each row shows snapshots from individual clathrin-coated pit traces. (A–E) Formation of pits (marked by a ring pattern) can be observed under various in vitro and in vivo conditions, including SUM-159 cells expressing fluorescently tagged endocytic markers (clathrin-mRuby, AP2-EGFP, and CALM-EGFP, respectively) (A), BSC-1 cells expressing clathrin-EGFP (B), COS-7 cells expressing clathrin-mEmerald (C), MEF cells expressing clathrin-mEmerald (D), and amnioserosa and germ-band tissues of Drosophila embryos expressing clathrin- mEmerald (E). Two traces are shown for each condition. Scale bars, 200 nm.

Article Snippet: Fly maintenance, husbandry, and transgene expression To construct pUAST-mEmerald-Clc, the in-frame GFP fusion from pUAST-GFP-Clc (Chang et al., 2002) was excised with an EcoRI/ BglII digest and replaced with mEmerald (Addgene; Plasmid #53976), PCR amplified with primers GGAATTCCACCATGGTGAG CAAGGGCGAGG and CGAGATCTGAGTCCGGACTTGTACAGCTCGTCCATG (the EcoRI and BglII sites in the primers are underlined).

Techniques: Imaging, Cell Culture, In Vitro, In Vivo, Expressing

Journal: Developmental cell

Article Title: De novo endocytic clathrin coats develop curvature at early stages of their formation.

doi: 10.1016/j.devcel.2021.10.019

Figure Lengend Snippet: Figure 3. Clathrin coats reach maximum projected area by formation of domes and pits (A) Average clathrin-coated pit formation images using 34 and 81 individual traces are obtained from COS-7 cells expressing clathrin-mEmerald and BSC-1 cells expressing clathrin-EGFP, respectively (Videos S4 and S5). In both cases, the area of the average image increases monotonically until a plateau is reached, which is followed by a relatively sharp decrease. (B) For both cell types, average images of clathrin coats are shown for four equally spaced % completion points, last of which is the maximum area point (denoted as t1, t2, t3, and max area in [A]). Note that the ring pattern becomes apparent as the area converges to the maximum. Below each image is the radial average (red circles), which is obtained along a cross-section rotated 180 around the center. We used two Gaussian fits to the radial average (green and blue) to calculate the peak-to-peak separation as an estimate of the ring size. Scale bars, 90 nm. (C) Detected area of the T = 7 and T = 9 structures obtained from high-NA TIRF-SIM simulations are plotted with respect to % completion. (D) Lifetime distributions of manually selected clathrin-coated pit traces detected from BSC-1 cells expressing clathrin-EGFP (upper) and COS-7 cells expressing clathrin-mEmerald (lower).

Article Snippet: Fly maintenance, husbandry, and transgene expression To construct pUAST-mEmerald-Clc, the in-frame GFP fusion from pUAST-GFP-Clc (Chang et al., 2002) was excised with an EcoRI/ BglII digest and replaced with mEmerald (Addgene; Plasmid #53976), PCR amplified with primers GGAATTCCACCATGGTGAG CAAGGGCGAGG and CGAGATCTGAGTCCGGACTTGTACAGCTCGTCCATG (the EcoRI and BglII sites in the primers are underlined).

Techniques: Expressing